Table 2.

Primer and beacon sequences

NamePrimerSequence 5′-3′
CD133P1AATTCTAATACGACTCACTATAGGGAAGAACAGGGATGATGTTGGGTCTCA
P2TTTCAAGGACTTGCGAACTCTCTTGA
MBCGATCCAAGGACAAGGCGTTCACAGGATCG
CD146P1AATTCTAATACGACTCACTATAGGGAGAGGGGCTAATGCCTCAGATCGATGTA
P2CCCCCGTCTCGTAAGAGCGAA
MBCGATCCTTAAGTCAGATAAGCTCCCGGATCG
U1AP1AATTCTAATACGACTCACTATAGGGAGAGGCCCGGCATGTGGTGCATAA
P2TGCGCCTCTTTCTGGGTGTT
MBCGCATGCTGTAACCACGCACTCTCCTCGCATGCG
  • NOTE: The T7 promoter moiety of primer P1 sequences is shown in italics, the stem sequences of the molecular beacon probes are shown in bold.