Table 2.

Primers used for comparative duplex PCR

TSG exonPrimer sequence (5′→3′)
Annealing temperature (°C)
SenseAntisense
p15INK4b exon 1AATGCGCGAGGAGAACAAGCGGCTTCCAGGAGCTGTC60
p15INK4b exon 2CTTCCTGGACACGCTGGTGCAGGTACCCTGCAACGTC60
p14ARF exon 1βAGTTAAGGGGGCAGGAGTGATCCGGAGGGTCACCAAG61
β-globinACACAACTGTGTTCACTAGCGCAGACTTCTCCTCAGGAG