Table 1.

Primers for real-time PCR

GeneReference sequenceForward primerReverse primer
BUB1NM_004336GAGTGATATCTTCAGCTTGTG (633-653)AACAACCTGCTCAACATCAAC (734-754)
BUB1BACGTTATTAGAAAGAGCTGTAG (432-453)CATATCCAAAGGCTCATTGC (529-548)
BUB3NM_004725ATGCGGCTCAAGTACCAGC (215-233)GATCAGTGTTCAAATCATGC (313-332)
MAD2L1NM_002358GCGCGTGCTTTTGTTTGTG (47-65)AGTAAAGGTTTCAGATGGATAT (185-206)
MAD1L1NM_003550TACCAGATCGACATCACCAC (2091-2110)TCTCCAGTAGCTGCATCTTG (2194-2213)
MAD2L2NM_006341TGCATCTCATCCTCTACGTG (191-210)TCCTGGATATACTGATTCAGC (288-308)
CDC20NM_001255CCTCTGGTCTCCCCATTAC (1325-1343)ATGTGTGACCTTTGAGTTCAG (1420-1440)
TTKNM_003318AATGCTGGAAATTGCCCTGC (608-627)GAACCGGAAAATGATTCTTGG (707-727)
ACTBNM_001101AATCTGGCACCACACCTTCTA (325-345)ATAGCACAGCCTGGATAGCAA (474-494)