Table 1.

Primer and probe sequences for HPV DNA quantification

GeneForward primerReverse primerProbe
HPV 16-E7ccggacagagcccattacaatacgtgtgtgctttgtacgcactgttgcaagtgtgactctacgcttcggt
HPV 18-E7gactcagaggaagaaaacgatgaaagtgacgttgtggttcggcttggagttaatcatcaacatttacca
β-globingacaggtacggctgtcatcatagatggctctgccctgactctagggttggccaatctactcccag
DCCggaacgagcattgaatacaacaaggctgtgtggccacctttggggaccgggagagagttc