Table 2.

Primer sequences for mRNA quantification

NameGenomic positionSequence
HPV 16 full length (forward)211-234gttactgcgacgtgaggtatatg
HPV 16 full length (reverse)278-305catttatcacatacagcatatggattc
HPV 16 E6*I (forward)214-237actgcgacgtgaggtgtattaac
HPV 16 E6*I (reverse)460-481tggaatctttgctttttgtcc
HPV 16 E6*II (forward)211-232gttactgcgacgtgagatcat
HPV 16 E6*II (reverse)566-589tcatgcaatgtaggtgtatctcc
HPV 18 full length (forward)229-252cagaggtatttgaatttgcattt
HPV 18 full length (reverse)292-314aatctatacatttatggcatgcag
HPV 18 E6* (forward)223-243aacttacagaggtgcctgcg
HPV 18 E6* (reverse)486-506tagtgcccagctatgttgtg
  • NOTE: Genomic positions based on Genbank sequences K02718 and X05015 for HPV 16 and HPV 18, respectively.