Table 1.

Primers for MSP

GenesPriming siteForward primer (5′ to 3′)Reverse primer (5′to 3′)PCR product size (bp)
RAMP2GenomicAGCCCCTCCGAGGAAGCGGCGCGCGGGCCGCCGGCGCGCTCCACCCG
MSP (M)AGTTTTTTCGAGGAAGCGGCGCAACCGCCGACGCGCTCCACCCG146
MSP (U)AGTTTTTTTGAGGAAGTGGTGTCAAACCACCAACACACTCCACCCA148
EFEMP1GenomicGAGCAGCTCCAGGGGACCGCCGCGTCCCCGACACGCTACCTTCG
MSP (M)GTAGTTTTAGGGGATCGTCGCTCCCCGACACGCTACCTTCG160
MSP (U)GAGTAGTTTTAGGGGATTGTTGTTCCCCAACACACTACCTTCA162
Dutt1GenomicAAGCGTCCGGAAAGGTCGACGGTAAAAGTGAGCGGGCTGCG
MSP (M)AAGCGTTCGGAAAGGTCGACATAAAAATAAACGAACTACG196
MSP (U)AAGTGTTTGGAAAGGTTGATATAAAAATAAACAAACTACA196
  • NOTE: M, methylated sequence; U, unmethylated sequence.