Table 1.

Summary of primer sequences, PCR conditions, and restriction enzymes used for bisulfite-PCR

Gene or CpG islandPrimer sequenceAnnealing temperature, °C (no. cycles)Restriction enzyme for COBRA
COBRA
    MINT1-FGGGTTGGAGAGTAGGGGAGTT55 (40)TaqI
    MINT1-RCCATCTAAAATTACCTCRATAACTTA
    MINT31-FGAYGGYGTAGTAGTTATTTTGTT58 (3), 56 (4), 54 (5), 52 (28)BstUI
    MINT31-RCATCACCACCCCTCACTTTAC
    P16-FGGTTTTGGYGAGGGTTGTTT58 (3), 56 (4), 54 (5), 52 (28)EcoRV
    P16-RACCCTATCCCTCAAATCCTCTAAAA
    P14-Fttagtttgtagttaagggggtaggag58 (3), 56 (4), 54(5), 52 (28)TaqI
    P14-RAAAAATCACCAAAAACCTAC
    MLH1-FTAGTAGTYGTTTTAGGGAGGGA60 (5), 57 (5), 54 (5), 51 (25)RsaI
    MLH1-RTCTAAATACTCAACRAAAATACCTT
MSP
    MINT2-MFTTGTTAAAGTGTTGAGTTCGTC60 (40)
    MINT2-MRAATAACGACGATTCCGTACG
    MINT2-UFGATTTTGTTAAAGTGTTGAGTTTGTT60 (40)
    MINT2-URCAAAATAATAACAACAATTCCATACA