Table 2.

Real-time PCR primer and probe design

GeneForward primer (5′-3′)Reverse primer (5′-3′)TaqMan probe (5′-3′)
ACTBCTTCCTGGGCATGGAGTCCACGTCACACTTCATGATGGAGTTATCCACGAAACTAC
CHDHGCATCGGGAATGCTGATGAGGCCAACCCCAGGTAGGTCAAGAAACTGGGCATCC
ESR1ATGATCAACTGGGCGAAGAGGTGGACCTGATCATGGATGCCAGGCTTTGTGGA
HER2CCTCTGAGACTGATGGCTACGTTGAACATCTGGCTGGTTACCATATTCCCCTGACCTGCAGC
HMBSCTGCCCACTGTGCTTCCTTTTTCCCGCTTGCAGATGCTGGCTTCACCATCGG
HOXB13TGTTGCCAGGGAGAACAGAACCGCTGGAGTCTGCAAATGCTACCAGGTCCCTTTTG
IL17BRGAGCCGACCGTTCAATGTAGATCATGTTGTAGCATCCACTCTCTGAAACTGGGCCATC
PGRCATTGCCAGGTTTTCGAACCAAGAATACTGAATGAGAGTTATCACTTACATATTGATGACCA
PS2CCACCGGACACCTCAGACAGAGTAGTCAAAGTCAGAGCAGTCAATCTCTGCAGCTGTGCCTCGGCTCAC
UBCGATTTGGGTCGCGGTTCTTCTGCATTGTCAAGTGACGATTTGTGGATCGCTG