Table 1.

List of genes and their target sequences of shRNA plasmids used to identify cellular targets of i-Extract

Serial numberAccession numberGene nameTarget sequence
1NM_004936CDKN2BAATAGAGGTTGAACTTCAA
2NM_004517ILKGATCTAAATTTGACGTGAT
3NM_004517ILKGCGGGGATTTCAATGGAGA
4NM_004064p27 Kip1AAGGGAGGGTTTATGTAGA
5NM_004064p27 Kip1GAGGCAGTTGATATTTCAT
6NM_002611PDK2GGTCCAATTCTAAGGTGGA
7NM_002611PDK2AGGTCAACTTGCTTCTCGA
8NM_002610PDK1GCTGGAGCTTAGAAGTCTA
9NM_002610PDK1AATGGGAATTGAATTTCAT
10NM_002498NEK3GCTCCAGTATGGATGGCTA
11NM_002498NEK3GTTTGGGAATTGAATGTAT
12NM_002497NEK2GCTGGAATGTTAAACTATA
13NM_002497NEK2GATAGAAGTTGAGAAGCAA
14NM_002376MARK3GAGGTAAGATTTAAATTTA
15NM_002376MARK3AGTAAGGCCTCGATCTCTA
16NM_002314LIMK1GCTAGAGGATTTATGGTGA
17NM_002314LIMK1ACGAGAGGTTCAATTTCAT
18NM_001800CDKN2DGGTAGAGTATTTAAGGGTA
19NM_001800CDKN2DGGGAGGAATACTTTCTCTT
20NM_001799CDK7GGGTAAAGTGTTATGGGAA
21NM_001799CDK7GGATATAAATTTAATGTTA
22NM_001798CDK2GCTATAATGTTTATAGAGA
23NM_001798CDK2GGGTGAATAATTATGTTTA
24NM_001262CDKN2CGTTCTGATATGTAGTTGCA
25NM_001262CDKN2CATGTGAACGTTAATGTACA
26NM_001261CDK9GGTCAAATGTGGACAGCTA
27NM_001261CDK9GCTAGAGGGTGGCTTTGAA
28NM_001260CDK8GCTTGAATATTCAACGTTA
29NM_001260CDK8GATAGAATATTTAGTGTAA
30NM_001259CDK6GATTAAGATTTGACCGCTT
31NM_001259CDK6GCGAAGATCTATTTCTGAA
32NM_001258CDK3GCGGTAAGTTCTATATCAA
33NM_001258CDK3GGGAGGGATTGGAAGGGAT
34NM_000077CDKN2AACTAGAGAGGTTCTGGGAA
35NM_000077CDKN2AATTGCGGTGTCGCATGGTA
36NM_000076CDKN1CGTGTGAAGCTTTGAGGGTA
37NM_000076CDKN1CGTTCTAAAGTGTAAGGCTT
38NM_000075CDK4GGGTGAGGGTAATCTGGAA
39NM_000075CDK4AGGGTAGTCTTTGTCTTTA
40NM_138793SHAPYGCGGGGGGTTGTAGGGAAA
41NM_138793SHAPYGCGTGGAATATGAGGGCAT
42NM_000314PTENGGTGGAGCTTGCAATTCTA
43NM_000314PTENGGGATAATATTGATGGTGT
44NM_000546p53GCTAAAGAAGAAATCGCA
45NM_000546p53GCTGGGAGGGTTAATATCT
46NM_000077p16INK4AGAGTGTGAGAGTCTCTAAT
47NM_000077p16INK4AGATAACTCTGATGTTTGAG
48NM_015322FEMATTTCATGtTATAAAGGAC
49NM_015322FEMGTCATAAACTTGCACAGAC
50NM_002156HSP60GGTACTAGCTCTTCATTTC
51NM_002156HSP60GCTCGAGTCTTAATGCTTG
50NM_002156HSP60GGTACTAGCTCTTCATTTC
51NM_002156HSP60GCTCGAGTCTTAATGCTTG
52NM_003156STIM1GGGAAGACCTCAATTACCA
53NM_003156STIM1GGCCAAGAAGACATTTATA
54NM_014622AW551984GAACAAACTTCTATCTTTA
55NM_014622AW551984AGTCAAACTTGTAAATAGA
56NM_007215POLG2GAAGCAAACTTTACTACAA
57NM_007215POLG2GGGAAAGGAGCCAATAGAA
58NM_016248PRKA-2GTGAAGCTTTATCAAATGC
59NM_016248PRKA-2ACAAACATGGAAAGTCATG
60NM_005923MAP3K5GGGACAGCTTTCAAATTAA
61NM_005923MAP3K5ATCTGTTTCTGTATAGAAT
62NM_004672MAP3K6.GTGGGTTGCTTAAGGTTTC
63NM_004672MAP3K6.AGGGATCGTTCTTCACAGA
64NM_145333MAP3K7GGGTGAATTTGGATGTTTA
65NM_145333MAP3K7AGGTGTTGCTATTAAATAA
66NM_005204MAP3K8GTAAGCACCTTCACTGGAG
67NM_005204MAP3K8AGGAAGTGATTCATTATGA
68NM_001880ATF2GGGTAGTCCTTTATCTCAC
69NM_001880ATF2AGTTCTGGCTTAAGTGTAG
70NM_002759PRKRAAGATTAATTGTAAATTG
71NM_002759PRKRATTGGTCGCTAAATTTGCG
72NM_005157ABL1GGTCCTAGCTTTATGCTCG
73NM_005157ABL1GTTCAGCTCTGCTACCTAT
74NM_001626AKT2ATCTCATGTTGGACAAAGG
75NM_001626AKT2GGCTTCGATTATCTCAAAT
76NM_001166BIRC2AGGAGTTACTATAACCCTA
77NM_001166BIRC2GGATATGTCTCTAATGAGA
78NM_001165BIRC3ACTTTGACTTTCATTCTAG
79NM_001165BIRC3AGCTTTAAATGTATAGAAA
80NM_001167BIRC4GTATCATACTGTAACTGAA
81NM_001167BIRC4GTGTTGGACTTTACTACAC
82NM_001168BIRC5ATTGTTGATTCATAGAATG
83NM_001168BIRC5GTAGGTTCCTTGTCTGTCA
84NM_000633BCL2αAGTGTGAATTTAAACTTTA
85NM_000633BCL2αAAGTAAGGCTTTGAATGAT
86NM_004935CDK5ATGGTGGCCTTGATCTTGA
87NM_004935CDK5GGGTGGGGTTGGATGATGA
88NM_023109FGFR1GGTGGAACCTTCACGCCGG
89NM_023109FGFR1ATTTAAACCTGATCACAGA
90NM_000142FGFR3GTGTATATTTCTGTAAATG
91NM_005248FGRGGTCCGGCCTGTATCCTCG
92NM_005248FGRGGGCCCATCTATATCGTGA
93NM_000875IGF1RATACCATCCTGCATAATAC
94NM_000875IGF1RAGTTATGGTTTAAATTTAA
95NM_000208INSRGGTGAGATTTATATGATTA
96NM_000208INSRGGAATGACTTTCATTCTGG
  • NOTE: shRNA (1, 12, 36, 44, 78, and 86) that resulted in the abrogation of the effect of i-Extract are indicated in bold.