Table 1.

Primers and probes used for real-time PCR

GenePrimer or probeSequence (5′-3′)
GAPDHForward primerTGAACGGGAAGCTCACTGG
Reverse primerTCCACCACCCTGTTGCTGTA
Donor probeCTGAGGACCAGGTTGTCTCCTGCGA
Acceptor probeTTCAACAGCAACTCCCACTCTTCCACC
iNOSForward primerGCAAACCCAAGGTCTACGTT
Reverse primerGGAAAAGACTGCACCGAAGA
Donor probeTGGTAGCCACATCCCGAGCCAT
Acceptor probeCGCACATCTCCGCAAATGTAGAGG
TNF-αForward primerCCACGTCGTAGCAAACCAC
Reverse primerTGGGTGAGGAGCACGTAGT
Donor probeTGGTGCCAGCCGATGGGTTGTAC
Acceptor probeTTGTCTACTCCCAGGTTCTCTTCAAGG
PPARγForward primerGAGTTCCTCAAAAACCTGCG
Reverse primerTGTCTTGGATGTCCTCGATG
Donor probeCAATGCACTGGAATTAGATGACAGTGACTTGGCTA
Acceptor probeATTTATAGCTGTCATTATTCTCAGTGGAGACCGCCC
COX-2Forward primerCCATCTGTTCTCCTCAATAC
Reverse primerTTTGGTAGGCTGTGGAT
Donor probeACCTTTGGAGGCGAAGTGGGTTTTAAGATC
Acceptor probeTCAATACTGCCTCAATTCAGTCTCTCATCTGCA
  • NOTE: Donor probes were labeled at the 3′ end with fluorescein. Acceptor probes were labeled at the 5′ end with LightCyler Red 640.