Table 2.

Characteristics of the PCRs

GeneForwardReverseCT
VEGFAGAGTGTGTGCCCACTGAGGAGTCCAACCTCCTGCCCGGCTCACCGCCTCGGCTT4055
VEGFCGATCTGGAGGAGCAGTTAGGGAGTTGAGGTTGGCCTGTTC4055
KDR (exon)CGGAGTGACCAAGGATTGTACTCTCCTGCTCAGTGGGCTGCATGT2556
KDR (nested)TGGAAGTGGCATGGA ATCTCTTGCCGCTTGGATAACAAGG3253
FLT4CAAGCCATCCGAGGAGCTACGTCTTGCACTTCGCACACATAGTGG4058
β-ActinGCTGTGCTACGTCGCCCTGGGAGGAGCTGGAAGCAGCC4061
  • NOTE: VEGFA, VEGFC, and β-actin mRNA expression were detected with a quantitative PCR. A nonquantitative PCR was done to detect KDR (using a nested PCR) and FLT4 mRNA expression.

    Abbreviations: Forward and reverse, specific primers; T, annealing temperature given as °C; C, cycles.