Table 2.

List of primers and PCR conditions

PrimerForward (5′-3′)Reverse (5′-3′)Tm (°C)Product (bp)
RT-PCR
Human MAGE-A3gagattctcgccctgagcccactggcagatcttctccttc57152
Human MAGE-A3/6caacgagcgacggcctgacccactggcagatcttctccttc59134, 198
Human FGFR2 IIIbagtgctggctctgttcaatgtgggcgattaagaagacccctatg58202
Human p53actaagcgagcactgcccaaccctcattcagctctcggaacatc60130
Human p21tggagactctcagggtcgaaaaccaggactgcaggcttcctgtg60121
Human PGKgctgacaagtttgatgagaataggactttaccttccaggagc58338
Mouse MAGE-A3gatgactgatgtccagggtatgcgcacaaactcctcagagatgagc60188
Mouse p53cacagcgtggtggtaccttatgaaggttcccactggagtcttcc59153
Mouse GAPDHatcactgccacccagaagactcatgccagtgagcttcccgtt56152
Mouse ERαaatgatgggcttattgaccaacccgagaccaatcatcagaatctcc59152
Mouse ERβgtctgcagtgattatgcatctggagcttttacgccggttcttgtc59151
Human bisulfite sequencing and COBRA
MAGE-A3 BS (outer)gtattaattttaggattttgagggatgttaaaaccctctatctaaaataaaacc56392
MAGE-A3 BS (inner)gattttattaggatttatagttttaggttaaaaccctctatctaaaataaaacc53329
Chromatin immunopreciptation
Mouse MAGE-A3actccaaatggcagggtaacttctctcttcgaggttgcagtattgg58279
Mouse p53ggcggtccacttacgataaaaacactcctggcacaaagctggatag58262
  • Abbreviations: ER, estrogen receptor; COBRA, combined bisulfite restriction analysis.