Table 2.

Sequence of primer pairs and annealing temperature for the genes validated by RT-PCR

PrimersSequenceAT (°C)
Hsp40-FAGATCTTCGACCGCTACGGG59
Hsp40-RAGCAAACATGGCATGAGGG
RAD50-FAAGCCCAGTTAACATCTTCAAAGG59
RAD50-RTTCTTTCGGCTATCCAAGGC
TPMT-FTGTGGAAATCAGTGAACTTGGG59
TPMT-RACAGTACAATGAAATGTTCCCCG
TBX21-FTGGGTGCAGTGTGGAAAGG59
TBX21-RCAAATGAAACTTCCTGGCGC
XRCC3-FCACTTGCTGAGAACGGCCTCC59
XRCC3-RAACCGCTCCTTCTGCTGGTGC
EPHX2-FGCTAATCTGAAGCCAGCCCG59
EPHX2-RTGGATTGCAAGAGGTCGGC
POLG2-FTTGACACTAAGCAGATACGAAATGG59
POLG2-RTTGAAGTTCTCGGAGGAGTAAACC
Rap2a-FTCTACAGCCTCGTCAACCAGC59
Rap2a-RTCCCAACCAAGATGACTGGC
E2F2-FAACGTGCTGGAAGGCATCC59
E2F2-RGGTCTTCAAACATTCCCCTGC
BATF-FAGAGGCAGACACAGAAGGCC63
BATF-RATCTCCTTGCGTAGAGCCGC

Abbreviations: F, forward; R, reverse; AT, annealing temperature.