Table 2.

Primer sequences used

Primer namePositionSequence (5′-3′)Gene nameAccession no.
NFATc2_1842_R1842-1823CGCGTGTTCTTTCTTCCAATNFATc2NM_012340
NFATc2_867_F867-886CCTCGCCAATAATGTCACCTNFATc2NM_012340
NFATc2_3220_R3220-3202CGCTTAGTGCCCATACATTNFATc2NM_012340
EWSR1_731_F762-783TCAATCTAGCACAGGGGGTTACEWSR1NM_005243
EWSR1_1561_R1561-1542CATAGGACACTGTGGCATCGEWSR1NM_005243
EWSR1_755_F755-777GTCAACCTCAATCTAGCACAGGGEWSR1NM_005243
EWSR1_271_F271-290GGAGACGGACGTTGAGAGAAEWSR1NM_005243
FLI1_1053_R1053-1040CTGTCGGAGAGCAGCTCCAGFLI1NM_002017
ERG_1064_R1064-1044CTGTCCGACAGGAGCTCCAGERGNM_182918
  • NOTE: To detect the EWSR1-NFATc2 fusion transcript, the primers EWSR1_731_F and NFATc2_1842_R were used. To detect the NFATc2-EWSR1 fusion transcript, the primers NFATc2_867_F and EWSR1_1561_R were used. As controls to detect EWSR1-FLI1 or EWS-ERG fusion transcripts, EWSR1_755_F and FLI1_1053_R or EWSR1_755_F and ERG_1064_R were used, respectively. To detect the normal NFATc2 transcript, NFATc2_867_F and NFATc2_1842_R were used, and for the EWSR1 normal transcript, EWSR1_755_F and EWSR1_1561_R were used.