Table 1.

Oligonucleotide primer sequences for the p53 gene amplification and sequencing

ExonPrimers for gene amplificationSize (bp)Primers for sequencing
Exon-4S 5′TCCCCCTTGCCGTCCCAA3′279S 5′TCCCCCTTGCCGTCCCAA3′
A 5′CGTGCAAGTCACAGACTT3′A 5′CGTGCAAGTCACAGACTT3′
Exon-5S 5′TTTCAACTCTGTCTCCTTCCT3′229S 5′CCTTCCTCTTCCTGGAGTAC3′
A 5′GCCCCCAGCTGCTCACCATC3′A 5′AGCTGCTCACCATCGCTATC3′
Exon-6S 5′CACTGATTGCTCTTAGGTCTG3′144S 5′TCTTAGGTCTGGCCCCTCCT3′
A 5′AGTTGCAAACCAGACCTCAG3′A 5′ACCAGACCTCAGGCGGCTCA3′
Exon-7S 5′GTGTTGTCTCCTAGGTTGGC3′150S 5′CCTAGGTTGGCTCTGACTGT3′
A 5′TGTGCAGGGTGGCAAGTGGC3′A 5′GGGTGGCAAGTGGCTCCTGA3′
Exons 8-9S 5′CCTATCCTGAGTAGTGGTAA3′346S 5′TGGTAATCTACTGGGAGCAG3′
A 5′ACTTGATAAGAGGTCCCAAG3′A 5′CCCAAGACTTAGTACCTGAA3′
  • Abbreviations: S, sense primer; A, antisense primer.