Table 3

Primers used for amplification of intragenic simple nucleotide repeats

GeneRepeatPCR product (bp)Primers (5′-3′)
E2F4(AGC)n167ACAGTGGTGAGCTCAGTTCACTC
AAAGGAGGTAGAAGGGTTGGGTC
TGF-βRIIpoly(A)10140ACAGTTTGCCATGACCCCAAG
TCATTGCACTCATCAGAGCTACAGG
IGFIIRpoly(G)8110GCAGGTCTCCTGACTCAGAA
GAAGAAGATGGCTGTGGAGC
BAXpoly(G)894ATCCAGGATCGAGCAGGGCG
ACTCGCTCAGCTTCTTGGTG