Table 5

Spectrum of p53 mutations and distant metastases in ovarian cancer

Fam. no.Mutation typeExonMutationaSpecificsbSite of metastasisTimec (yrs)
198Deletion513111 del 32→ter 169TGCAGCTGTGGGTTGATTCCACACCCC-CGCCCGGCACCCGdLiver0
96.11Deletion412108 del 4→ter 121ATGAAGCTLiver0
314Deletion412108 del 4→ter 121ATGAAGCTLiver0
213Insertion613362 ins T→ter 208AATTTTGCGTdLiver0
350Deletion613393 del T→ter 246ACACTTTTCLiver and lungs0
131.2Deletion513207 del C→ter 246GCTGCCCCCdLiver0
Lungs1.02
420Deletion814546 del G→ter 344GAAAGGGGALiver0
31Deletion412139 del G→ter 122CCCCGCGTGdMediastinum0
316Insertion412209 ins 17→ter 128ATCTCCTGGCCCCTGTCATCTTCTGLiver0.33
317Deletion914751 del TC→ter 335CTTCAGLiver0.42
100Deletion412108 del 4→ter 121ATGAAGCTLiver0.67
88Deletion513231 del TA→ter 207CAGATAGCGAdLiver1.13
278Missense8Val 272 PheCTG→TTGLiver1.38
61Deletion613331 del C→ter 246CCCTCCTCAdLiver1.42
60Missense5Cys 135 TyrTGC→TACLiver1.52
81Deletion714010 del AC→ter 238TCTGACTGTAdLiver1.52
22.1Nonsense5Gln 165 TerCAG→TAGBrain1.58
3Deletion714049 del C→ter 246GTTCCTGCdBrain1.83
29.2NoneLiver1.82
159Deletion814571 del C→ter 322CCCCCAGGGdLiver1.83
311Deletion814496 del 56→ter 304TGTGCCTGTCCTGGGAGAGACCGGCGCACAGAGGAAGAGAATCTCCGCAAGAAAGGGGAGCCTCLiver and spleen1.91
103Missense8Arg 273 LeuCGT→CTTLiver2.17
8Missense4Gly 105 ValGGC→GTCLiver3.72
20Deletion714075 del 7→ter 323GAGGCCCATCCTCACdLiver3.98
107.2NoneLiver4.25
288NoneLung and pericardium4.62
76Splice9CAGgt→CAGacLiver and lungs3.75
11Missense5Val 172 PheGTT→TTTdLiver4.75
84Deletion814566 del C→ter 344AGCTGCCCCdBrain4.75
  • a For deletion and insertion mutations, the mutation description contains the nucleotide, the deletion (del) or insertion (ins), the specific nucleotides changed (if <3) or the number of base pairs changed (if >2), and the codon in which the frameshift results in a termination (ter) signal. For nonsense and missense mutations, the wild-type amino acid and affected codon are described.

  • b Mutation sites are underlined.

  • c Time to development of distant metastasis. Time 0 reflects the presence of distant metastasis at the time of presentation.

  • d Previously reported mutations (24 , 35) .