Table 2

%Sequence of PCR primers used for amplification of the indicated exons in p16INK4 and p15INK4b

ExonSense (5′-3′)Antisense (5′-3′)
p15
Exon1TTAAGTTTACGGCCAACGGTGGATTGTACAAATCTATTTTCATCGCGATCTA
Exon2TCTTTAAATGGCTCCACCTGCCTTTCCCCGGGTTGGCAGCCTTCATCGA
p16
Exon1CGGAGAGGGGAGAGCAGTGCAAACTTCGTCCTCCAGAGTC
Exon2TTAGGACACCTGGGGTTGTGTGTGGAAGCTCTCAGGGTACAAATTC