Table 1

Primers 1–4 and 23-mer probe sequence and location in the MMTV ENV gene

DesignationSequence (5′–3′)Location
1CCTCACTGCCAGATC976–990
2TACATCTGCCTGTGTTAC1388–1405
3ATCTGTGGCATACCT1640–1626
4GAATCGCTTGGCTCG1661–1647
23-mer probeCCGCCATACGTGCTGCTACCTGTA1554–1577