Table 1

PCR primers

Primer pairMethylated set (5′-3′; upstream/downstream) Unmethylated set (5′-3′; upstream/downstream)Primer positiona (product size)Annealing temperature
AluAAAATTAGTTCGGTGTGGTGGTGCGT−198966°C
TTTTTTCCTACAAAATCTCGTACTATCG−1847
(143)
AAAATTAGTTTGGTGTGGTGGTGTG−1989
TTTTTTCCTACAAAATCTCATACTATCACC−1847
(143)
NEP1GGGTCGGAGGGATGTTTAGGTGTTTC −29962°C
CTAAACCGACACATCCCGACCAATAAACG −103
(197)
GTGGGTTGGAGGGATGTTTAGGTGTTTT −302
AAACTACTAAACCAACACATCCCAACCAATA  −97
(206)
NEP2GCGGATGTACGGATTGAGAGGCG −19662°C
CCACAAACTCCCAACGCCCTAACG   −2
(195)
TGGGTGGATGTATGGATTGAGAGGTG −199
TCCCACAAACTCCCAACACCCTAACA   +1
(200)
  • a Relative to exon 2 transcription start.