Table 1

Sequences of primers used to identify each specific FABP

The sequence of primers and annealing temperatures were designed for specific recognition of each indicated FABP.
cDNAPrimerSequenceAnnealing temperatureAccession no.
A-FABP74–95GAAACTTGTCTCCAGTGAAAAC55J02874
564 –543GGGAGAAAATTACTTGCTTG
L-FABP29–51CTCTATTGCCACCATGAGTTTC50M10050
414–394GCTGATTCTCTTGAAGACAATCTG
H-FABP3–22ATTCGGCACGAGGTAGCTTC58X56549
529–507AGAGGAAGAAATGAGGCAATG
I-FABP72–92ACAGCACTTGGAAGGTAGACC52M18079
385–364TTCTCGGACAGTATTCAGTTCG
E-FABP4–22CCGACGCAGACCCCTCTC56M94856
438–414GATCCGAGTACAGGTGACATTGTTC
B-FABP44–65CGCTCCTGTCTCTAAAGAGGGG56D88648
639–618TGGGCAAGTTGCTTGGAGTAAC
Myelin-FABP37–53GAGCAACAAATTCCTGGC54D16181
430–408GACCTTCTCATAGATTCTGGTGC