Table 1

Sets of primers for PCR amplification and nucleotide sequencing of M40-β-tubulin-isotype

PrimersSequences
PCR primers
 Set 1Forward(5′–UTRa)CTTGCCCCATACATACCTTGA
Reverse(748–768)CTCCGCAAGTTGGCAGTCAAC
 Set 2Forward(574–594)TTGGATGAGAATACTGATGAG
Reverse(3′–UTR)GTAAGACGGCTAAGGGAACTG
Sequencing primers
 Set 3Forward(19–35)ATCCAGGCTGGTCAATG
Reverse(357–377)GTGGTACGGAAGGAGGCAGA
 Set 4Forward(283–301)TCTGGGGCAGGTAACAACT
Reverse(628–648)ATCTGCTTCCGCACTCTGAAG
 Set 5Forward(682–702)CTTGTCTCAGCCACCATGAGT
Reverse(1018–1038)ACTTTGTGGAATGGATCCCC
 Set 6Forward(985–1008)CAGATGCTTAACGTGCAGAACAAG
Reverse(1247–1267)CGACCTCGTCTCTGAGTATC
  • a UTR, untranslated region.