Table 1

Summary of primer sequences,a annealing temperatures, and PCR product sizes used for MSP

GeneForward primer (5′→3′)Reverse primer (5′→3′)Annealing temperature (°C)Product size (bp)
RASSF1A M: bGTGTTAACGCGTTGCGTATCM: AACCCCGCGAACTAAAAACGA6093
U: TTTGGTTGGAGTGTGTTAATGTGU: CAAACCCCACAAACTAAAAACAA60105
RARβ2 M: GGTTAGTAGTTCGGGTAGGGTTTATCM: CCGAATCCTACCCCGACG58235
U: TTAGTAGTTTGGGTAGGGTTTATTU: CCAAATCCTACCCCAACA58233
DAP-kinase M: GGATAGTCGGATCGAGTTAACGTCM: CCCTCCCAAACGCCGA5898
U: GGAGGATAGTTGGATTGAGTTAATGTTU: CAAATCCCTCCCAAACACCAA58106
p16 M: TTATTAGAGGGTGGGGCGGATCGCM: GACCCCGAACCGCGACCGTAA65150
U: TTATTAGAGGGTGGGGTGGATTGTU: CAACCCCAAACCACAACCATAA60151
p15 M: GCGTTCGTATTTTGCGGTTM: CGTACAATAACCGAACGACCGA60148
U: TGTGATGTGTTTGTATTTTGTGGTTU: CCATACAATAACCAAACAACCAA60154
p14 M: GTGTTAAAGGGCGGCGTAGCM: AAAACCCTCACTCGCGACGA60122
U: TTTTTGGTGTTAAAGGGTGGTGTAGTU: CACAAAAACCCTCACTCACAACAA60132
MGMT M: TTTCGACGTTCGTAGGTTTTCGCM: GCACTCTTCCGAAAACGAAACG6181
U: TTTGTGTTTTGATGTTTGTAGGTTTTTGTU: AACTCCACACTCTTCCAAAAACAAAACA6193
GSTP1 M: TTCGGGGTGTAGCGGTCGTCM: GCCCCAATACTAAATCACGACG6091
U: GATGTTTGGGGTGTAGTGGTTGTTU: CCACCCCAATACTAAATCACAACA6097
  • a References for primer sequences: Ref. 11 , 12 , 14 , and 22 23 24 25 .

  • b M, methylated-specific primers; U, unmethylated-specific primers.