Table 1

Primers used for PCR amplification of exon 2 of the N-ras gene

PrimerSequence (5′→3′)Product length
ForwardGATTCTTACAGAAAACAAGTG157 bp
ReverseATGACTTGCTATTATTGATGG
Nested forwardCAAGTGGTTATAGATGGTGA118 bp
Nested reverseATACACAGAGGAAGCCTTCG