Table 1

Primer sequence used for sequencing of the FTase subunits

PrimerSequence
FTAFOR2CTGTCCTGCAGCGTGATGAA
FTAFOR3TGCCTGGCCAGCATCGACAAT
FTAFOR4GATCGTGCTGTATTGGAGAG
FTABAK1ACCACTCTCGTGTGAAACTC
FTABAK2GGAACTATGACTTGGTTGTA
FTABAK3GCTGCCAGGCATGATAATTC
FTABAK4AGGACAGCTCGGAAGTAATC
FTBFOR2GTTCCTGGAGCTGTGTCAGA
FTBFOR3CGCGCTGGTAATCCTCAAGA
FTBFOR4GAGCCATGTTGCATGATGTG
FTBBAK1GGAGATGGGTGAGCAAAGAG
FTBBAK2TGGCAGCACATCAGGATGTA
FTBBAK3CTACGGAGGCAGCACAGTAT