Table 1

Genes studied

Gene/accesion no.Primers (coordinates)aRestriction enzyme/restriction sitesAnnealing temperatures (no. of cycles)
ER GGTTTTTGAGTTTTTTGTTTTG(300)BstUI60 (3), 57 (4), 54 (5), and 51 (25)
X03635AACTTACTACTATCCAAATACACCTC(505)1
p15 GGAGTTTAAGGGGGTGGG (24747)BstUI59 (37)
AC000049CCTAAATTACTTCTAAAAAAAAAC (24918)2
p16 GGTTTTGGYGAGGGTTGTTT (917)TaqI58 (3), 56 (4), 54(5), and 52 (23)
X94154ACCCTATCCCTCAAATCCTCTAAAA (1078)1
MDR1 GTTATAGGAAGTTTGAGTTT (140829)TaqI54 (3), 51 (4), 48 (5), and 45 (26)
AC002457AAAAACTATCCCATAATAAC (141001)1
C-ABL TTAATAAAGGGTTYGGAGAG (37356)TaqI58 (34)
U07563CTAAAATAAAATAAAACAAACCTACA (37633)2
THBS1 GGAGAGAGGAGTTTAGATTGGTT (46325)BstUI54 (34)
AC037198AATAAAAATTACTCCTAAAAAAC (46489)1
THBS2 ATTAGAAGGGGGATGATGTT (5571) TaqI 58 (37)
U79410ACCCTACAATACAAAATACTCC 5708)1
Myf3 TGTTGGAGAGGTTTGGAAAGG (9952)RsaI60 (3), 57 (4), 54(5), and 51(25)
AF027148AAAATCCRAAACCAATAAAAACAC (10141)1
CD10 TTYGGTTTTAGTTTGGAGTT (3665)BstUI58 (3), 56(4), 54(5), and 52(26)
X79438CCCTTTAAACCTTTCTCCCT (3843)1
p73 methylatedACCCCGAACATCGACGTCCG60 (34)
(Ref. 21 )GGACGTAGCGAAATCGGGGTTC
p73 unmethylatedATCACAACCCCAAACATCAACATCCA60 (34)
(Ref. 21 )AGGGGATGTAGTGAAATTGGGGTTT
  • a Y indicates C or T.