Table 1

p53 reverse transcription-PCR primer sequence and description

RDL#Base pair positionPrimer length (mer)SequenceProduct size (bp)
N5335167215′GACACGGTTCCCTGGATTGGC3′
N5336619225′GCAAAACATCTTGTTGAGGGCA3′452
N5337537225′GTTTCCGTCTGGGCTTCTTGCA3′
N5338904215′GGTACAGATCAGAGCCAACCTC3′367
N4433813205′ATTTGCGTGTGGAGATATTG3′
N44341389215′AGAAGATGGAGAATGTCAGATCT3′598